Sequence ID | >WENV170015507 |
Genome ID | AZIH01001793 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 803 |
End posion on genome | 727 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
gaacggtcaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCACCCGCCTTCTAAGCGGGTGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
tcaggtcgtt |
Secondary structure (Cloverleaf model) | >WENV170015507 Arg TCT a GCCA tcaggtcgtt G - C C - G G - C C - G C - G C - G G - C T G T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A TGGTC C - G C - G C - G G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |