Sequence ID | >WENV170015526 |
Genome ID | AZIH01002957 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 3636 |
End posion on genome | 3560 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
aacagcgaat |
tRNA gene sequence |
CGGGGCGTAGCGCAGCTTGGTAGCGCACTTGCATGGGGTGCAAGGGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
gattccgaca |
Secondary structure (Cloverleaf model) | >WENV170015526 Pro GGG t ACCA gattccgaca C - G G - C G - C G - C G + T C - G G - C T A T C A T C C A C G A A | | | | | A T C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |