Sequence ID | >WENV170015528 |
Genome ID | AZIH01003071 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 455 |
End posion on genome | 366 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gccgttgtta |
tRNA gene sequence |
GGTGAGTTGGCCGAGTGGCTGAAGGCGCGCCCCTGCTAAGGGCGTATAGGGGAAACTCTA |
Downstream region at tRNA end position |
ttttgatata |
Secondary structure (Cloverleaf model) | >WENV170015528 Ser GCT a GCCA ttttgatata G - C G - C T - A G - C A - T G - C T - A T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A G TATAGGGGAAACTCTATC C - G G - C C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |