Sequence ID | >WENV170015531 |
Genome ID | AZIH01003222 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 861 |
End posion on genome | 936 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcgccccaag |
tRNA gene sequence |
GCCGCTGTAGCTCAGATGGTAGAGCACGTCATTCGTAATGATGGGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
gaaatccaaa |
Secondary structure (Cloverleaf model) | >WENV170015531 Thr CGT g ACCA gaaatccaaa G - C C - G C - G G - C C - G T - A G - C T G T T T C C C A A G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A GGGTC C - G G + T T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |