Sequence ID | >WENV170015542 |
Genome ID | AZIH01003659 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 315 |
End posion on genome | 239 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tgacttttgc |
tRNA gene sequence |
GGAGCGGTAGTTCAGTTGGTTAGAATACCGGCCTGTCACGCCGGGGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ctttttcgaa |
Secondary structure (Cloverleaf model) | >WENV170015542 Asp GTC c GCCA ctttttcgaa G - C G - C A - T G - C C - G G - C G - C T G T T G C C C A T G A A + | | | | G T C T T G G C G G G C G | | | + T T G G A A T T T A A GGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |