Sequence ID | >WENV170015552 |
Genome ID | AZIH01004579 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 252 |
End posion on genome | 177 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgcctccagt |
tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTAGAGCAACTGACTTTTAATCAGTAGGTCTCCGGTTCGAAC |
Downstream region at tRNA end position |
ctcataacaa |
Secondary structure (Cloverleaf model) | >WENV170015552 Lys TTT t ACCA ctcataacaa G - C G + T G - C C - G C - G T + G G - C C A T A G G C C A T G A A | | | | | G T C T C G T C C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |