Sequence ID | >WENV170015554 |
Genome ID | AZIH01004617 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2195 |
End posion on genome | 2120 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgcctcgttt |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
attacgaaat |
Secondary structure (Cloverleaf model) | >WENV170015554 Lys TTT t ACCA attacgaaat G - C G - C G - C T - A C - G G - C T - A T A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |