Sequence ID | >WENV170015561 |
Genome ID | AZIH01005104 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 288 |
End posion on genome | 214 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gctgacttcg |
tRNA gene sequence |
GCGGGTATGGTATAGTGGCTATTACCTCAGCCTTCCAAGCTGAAGAGGCGGGTTCGATTC |
Downstream region at tRNA end position |
tttttcgctc |
Secondary structure (Cloverleaf model) | >WENV170015561 Gly TCC g TCCA tttttcgctc G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A T G A G | | | | | G G T A T G G C G G G C G | | | T T C T T A C T A C AGAG T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |