Sequence ID | >WENV170015584 |
Genome ID | AZIH01006525 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 11957 |
End posion on genome | 12033 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
tcgcgataat |
tRNA gene sequence |
GCCCCCGTAGCTCATCTGGATAGAGCGTCCCCCTCCTAAGGGGAAGGTAGCAGGTTCGAG |
Downstream region at tRNA end position |
ccctgatttg |
Secondary structure (Cloverleaf model) | >WENV170015584 Arg CCT t ACCA ccctgatttg G - C C - G C - G C - G C - G C - G G - C T G T C G T C C A C T A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A G AGGTA T - A C - G C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |