Sequence ID | >WENV170015588 |
Genome ID | AZIH01007191 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 3178 |
End posion on genome | 3262 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
taagaatgtt |
tRNA gene sequence |
GCCCGGGTGGTGAAACTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCC |
Downstream region at tRNA end position |
tatagaagaa |
Secondary structure (Cloverleaf model) | >WENV170015588 Leu GAG t ACCA tatagaagaa G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A C A A G | | | | | G T A G T G G C C G G C G | | | T T G A C A C T A G G TGGCGAAAGCTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |