Sequence ID | >WENV170015594 |
Genome ID | AZIH01008883 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 2194 |
End posion on genome | 2118 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
nnnnnnnnnt |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCGCCTGCCTTGCACGCAGGAGGTCATCGGTTCGAC |
Downstream region at tRNA end position |
aagagctatt |
Secondary structure (Cloverleaf model) | >WENV170015594 Ala TGC t ACAA aagagctatt G - C G - C G + T G - C G + T A - T T - A T C T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |