Sequence ID | >WENV170015614 |
Genome ID | AZIH01011490 |
Phylum/Class | [AZIH] marine sediment metagenome; enrichment culture of sample MGS-ANC(UA) from oil contaminated site at the Ancona Port |
Species | |
Start position on genome | 255 |
End posion on genome | 172 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cccgcaggct |
tRNA gene sequence |
GCCCAAGTGGCGGAATGGTAGACGCAGGGGATTCAAAATCCCCCGCCGCGAGGCGTGCCG |
Downstream region at tRNA end position |
gcagcctgtt |
Secondary structure (Cloverleaf model) | >WENV170015614 Leu CAA t ACCA gcagcctgtt G + T C - G C - G C - G A - T A - T G - C T G T C G G C C A T A A G | | | | | G G G G C G G C C G G C G | | | T T T A C G C A G A CGCCGCGAGGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |