Sequence ID | >WENV170015648 |
Genome ID | AZII01001022 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1584 |
End posion on genome | 1660 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tctactatgt |
tRNA gene sequence |
GCCTACATAGCTCAGTCGGTTAGAGCACCTGACTGTTAATCAGGGGGTCCTAGGTTCGAG |
Downstream region at tRNA end position |
cttatacatt |
Secondary structure (Cloverleaf model) | >WENV170015648 Asn GTT t GCCA cttatacatt G - C C - G C - G T + G A - T C - G A - T T G T G A T C C A T G A A | | | | | G C C T C G C T A G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |