Sequence ID | >WENV170015659 |
Genome ID | AZII01001626 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 17 |
End posion on genome | 91 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tttaacttaa |
tRNA gene sequence |
GGCCCCTTGGTCAAGCGGTTAAGACACCACCCTTTCACGGTGGTATCAGGGGTTCGAGTC |
Downstream region at tRNA end position |
tttattcatg |
Secondary structure (Cloverleaf model) | >WENV170015659 Glu TTC a ACCA tttattcatg G - C G + T C - G C - G C - G C - G T - A T G T T C C C C A C G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TATC C - G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |