Sequence ID | >WENV170015660 |
Genome ID | AZII01001626 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 108 |
End posion on genome | 183 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
catgtattac |
tRNA gene sequence |
GGGAGCATAGCTCAGCTGGGAGAGCATCTGCCTTACAAGCAGAGGGTCACAGGTTCGATC |
Downstream region at tRNA end position |
tacatggccc |
Secondary structure (Cloverleaf model) | >WENV170015660 Val TAC c ACCA tacatggccc G - C G - C G - C A - T G + T C - G A - T C T T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |