Sequence ID | >WENV170015682 |
Genome ID | AZII01002740 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 1008 |
End posion on genome | 933 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ttgtgataac |
tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCATCTGCTTTGCAAGCAGAGGGTCATCGGTTCGATC |
Downstream region at tRNA end position |
tcactctgca |
Secondary structure (Cloverleaf model) | >WENV170015682 Ala TGC c ACCA tcactctgca G - C G - C G + T G - C C - G C - G T - A C T T T A G C C A C G A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C G A A GGGTC T - A C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |