Sequence ID | >WENV170015687 |
Genome ID | AZII01003123 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 350 |
End posion on genome | 274 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aagttaaaat |
tRNA gene sequence |
AGGCCTGTAGCTCAGCTGGTTAGAGCGCACCCCTGATAAGGGTGAGGTCGGCAGTTCAAG |
Downstream region at tRNA end position |
attattcgat |
Secondary structure (Cloverleaf model) | >WENV170015687 Ile GAT t ACCA attattcgat A - T G - C G - C C - G C - G T - A G - C T G T C C G T C A C G A A | | | | | A T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |