Sequence ID | >WENV170015720 |
Genome ID | AZII01004844 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 9603 |
End posion on genome | 9678 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
atcgtcgatg |
tRNA gene sequence |
GTGGGTGTAGCTCAGTTGGTAGAGCCCCTGACTGTGACTCAGGTTGTCGAGGGTTCGAGT |
Downstream region at tRNA end position |
ttttacgatt |
Secondary structure (Cloverleaf model) | >WENV170015720 His GTG g CCCA ttttacgatt G - C T - A G - C G - C G + T T - A G - C T G T T T C C C A T G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A C TTGTC C - G C - G T - A G - C A - T C C T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |