Sequence ID | >WENV170015732 |
Genome ID | AZII01005455 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 17576 |
End posion on genome | 17660 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ggctaatttc |
tRNA gene sequence |
GGAGGGGTTCCCGAGCGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGGA |
Downstream region at tRNA end position |
tttttggtag |
Secondary structure (Cloverleaf model) | >WENV170015732 Tyr GTA c ACCA tttttggtag G - C G - C A - T G - C G - C G - C G - C T A T C C T C C A C G A T | | | | | G G G C C C G G A G G C G | | | T T C A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |