Sequence ID | >WENV170015734 |
Genome ID | AZII01005455 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 17774 |
End posion on genome | 17848 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
catgggtcaa |
tRNA gene sequence |
GCCCATATAGCTCAGGGGTAGAGCACTTCCTTGGTAAGGAAGAGGCCATCGGTTCAATTC |
Downstream region at tRNA end position |
gttgtatcta |
Secondary structure (Cloverleaf model) | >WENV170015734 Thr GGT a TCCA gttgtatcta G - C C - G C - G C - G A - T T - A A - T T T T T A G C C A G A A | | | | | A G C T C G A T C G G C G | | | | T T G G A G C T A A AGGCC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |