Sequence ID | >WENV170015745 |
Genome ID | AZII01006279 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 588 |
End posion on genome | 513 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agggtaaagc |
tRNA gene sequence |
GCTGGCGTAGCTCAGTAGGTAGAGCAGCTGACTTGTAATCAGCCGGTCGGGGGTTCGACT |
Downstream region at tRNA end position |
tattttctta |
Secondary structure (Cloverleaf model) | >WENV170015745 Thr TGT c TCCA tattttctta G - C C - G T - A G - C G - C C - G G - C T C T T C T C C A T G A A + | + | | G A C T C G G G G G G C G | | | | T T G G A G C T A A CGGTC G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |