Sequence ID | >WENV170015746 |
Genome ID | AZII01006279 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 422 |
End posion on genome | 339 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
acctttttgg |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGCGTAAGCTTCGGTG |
Downstream region at tRNA end position |
tatatatagt |
Secondary structure (Cloverleaf model) | >WENV170015746 Tyr GTA g ACCA tatatatagt G - C G - C A - T G - C G - C G - C G - C T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A A CGCGTAAGCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |