Sequence ID | >WENV170015759 |
Genome ID | AZII01006899 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 346 |
End posion on genome | 421 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
atgcaatatg |
tRNA gene sequence |
GTGGGCGTAGCTCAGTTGGTAGAGCACAGGATTGTGGCTCCTGGTGTCGAGGGTTCGATC |
Downstream region at tRNA end position |
tattctcgag |
Secondary structure (Cloverleaf model) | >WENV170015759 His GTG g CCCA tattctcgag G - C T - A G - C G - C G + T C - G G - C C T T T T C C C A T G A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A GTGTC C - G A - T G - C G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |