Sequence ID | >WENV170015770 |
Genome ID | AZII01008292 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 5749 |
End posion on genome | 5663 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gcatagcaaa |
tRNA gene sequence |
GCCGAGGTGGTGAAATTGGTAGACACGCTAGCTTCAGGTGCTAGTGCTCGCAAGGGCGTG |
Downstream region at tRNA end position |
attaagaaag |
Secondary structure (Cloverleaf model) | >WENV170015770 Leu CAG a ACCA attaagaaag G - C C - G C - G G - C A - T G - C G - C T G T T C T C C A T A A G + | | | | A T A G T G G G A G G C G | | | T T G A C A C T A G G TGCTCGCAAGGGCGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |