Sequence ID | >WENV170015780 |
Genome ID | AZII01008813 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 582 |
End posion on genome | 506 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
acgccgcaac |
tRNA gene sequence |
GGATTGGTAGCTCAGTTGGATAGAGCACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
cttctgcctt |
Secondary structure (Cloverleaf model) | >WENV170015780 Arg ACG c GCCA cttctgcctt G - C G - C A - T T + G T - A G - C G - C T A T C C T C C A T G A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |