Sequence ID | >WENV170015808 |
Genome ID | AZII01011017 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 104 |
End posion on genome | 21 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
atcggtaagt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCCTG |
Downstream region at tRNA end position |
tttactcctc |
Secondary structure (Cloverleaf model) | >WENV170015808 Tyr GTA t ACCA tttactcctc G - C G - C G - C C - G G - C A - T C - G T T A G G A C C A A C G | | | | | G A G C C G C C T G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |