Sequence ID | >WENV170015815 |
Genome ID | AZII01012122 |
Phylum/Class | [AZII] marine sediment metagenome; enrichment culture of sample MGS-BIZ(AMM) from oil contaminated site at the Bizerte |
Species | |
Start position on genome | 338 |
End posion on genome | 263 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
cgcccataaa |
tRNA gene sequence |
GCCGATGTAGCTCAGGTGGTAGAGCGGCTCATTCGTAATGAGTAGGTCAGCGGTTCGAAT |
Downstream region at tRNA end position |
ttttaatgac |
Secondary structure (Cloverleaf model) | >WENV170015815 Thr CGT a TCCA ttttaatgac G - C C - G C - G G + T A - T T - A G - C T A T T C G C C A G G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC G + T C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |