Sequence ID | >WENV170015829 |
Genome ID | AZIJ01000596 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4324 |
End posion on genome | 4240 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
catacccatc |
tRNA gene sequence |
GGGGGCGTGGCGAAATTGGTAGACGCACTGGATTTAGGTTCCAGCGCCGCAAGGTGTAAG |
Downstream region at tRNA end position |
aatttaaaaa |
Secondary structure (Cloverleaf model) | >WENV170015829 Leu TAG c ACCA aatttaaaaa G - C G - C G - C G - C G - C C - G G - C T G T T T C T C A T A A G | | | | | G T A G C G A A G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G T - A G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |