Sequence ID | >WENV170015838 |
Genome ID | AZIJ01000803 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 4696 |
End posion on genome | 4773 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttgctgttca |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCTGCTTTGGGAGCAGGAGGCCGCAGGTTCGA |
Downstream region at tRNA end position |
aaaccggaca |
Secondary structure (Cloverleaf model) | >WENV170015838 Pro TGG a ACAA aaaccggaca C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T T A G AGGCC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |