Sequence ID | >WENV170015850 |
Genome ID | AZIJ01001408 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1862 |
End posion on genome | 1949 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
acccgctaat |
tRNA gene sequence |
GGAGAAATGGCAGAGTGGTCGATTGCGGCAGTCTTGAAAACTGTTGAGGGTAACACCTCC |
Downstream region at tRNA end position |
aaagcccgtg |
Secondary structure (Cloverleaf model) | >WENV170015850 Ser TGA t GCCA aaagcccgtg G - C G - C A - T G - C A - T A - T A - T T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G + | | | T T T T T G C C G A G TGAGGGTAACACCTCC G + T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |