Sequence ID | >WENV170015862 |
Genome ID | AZIJ01001967 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3855 |
End posion on genome | 3781 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ccgcctgtgt |
tRNA gene sequence |
TCCGGCGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGTCGTAGGTTCGATCC |
Downstream region at tRNA end position |
aaataagccc |
Secondary structure (Cloverleaf model) | >WENV170015862 Asn GTT t GCCA aaataagccc T - A C - G C - G G - C G - C C - G G - C C T T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |