Sequence ID | >WENV170015866 |
Genome ID | AZIJ01002407 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 557 |
End posion on genome | 632 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
cgggtggcgt |
tRNA gene sequence |
GGGGCCGTAGCTCAGTTGGGAGAGCGCGTCGTTCGCAATGACGAGGTCGTCGGTTCGATC |
Downstream region at tRNA end position |
cttcacaaaa |
Secondary structure (Cloverleaf model) | >WENV170015866 Ala CGC t ACCA cttcacaaaa G - C G - C G + T G - C C - G C - G G - C C T T T A G C C A T G A A + | | | | G T C T C G G T C G G C G | | | | T T G G A G C G A G AGGTC C - G G - C T - A C - G G + T T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |