Sequence ID | >WENV170015900 |
Genome ID | AZIJ01003405 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 12831 |
End posion on genome | 12907 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
accccacaaa |
tRNA gene sequence |
CGGAGCATAGCACAGCCTGGTAGTGCACCTGGTTTGGGACCAGGGGGTCGTAGGTTCGAA |
Downstream region at tRNA end position |
tcatcttaaa |
Secondary structure (Cloverleaf model) | >WENV170015900 Pro TGG a ACCA tcatcttaaa C - G G - C G - C A - T G - C C - G A - T T A T C A T C C A C G A A | | | | | G C C A C G G T A G G C T | | | | T T G G T G C G T A A GGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |