Sequence ID | >WENV170015917 |
Genome ID | AZIJ01004192 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 66 |
End posion on genome | 150 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ggattttgat |
tRNA gene sequence |
GCAGGCGTGGTGGAATTGGTAGACACGCTAGACTTAGGATCTAGTGCCGTGAGGTGTGAG |
Downstream region at tRNA end position |
ataaaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170015917 Leu TAG t ACAA ataaaaaaaa G + T C - G A - T G - C G - C C - G G - C T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G G TGCCGTGAGGTGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |