Sequence ID | >WENV170015920 |
Genome ID | AZIJ01004315 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1286 |
End posion on genome | 1362 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atttgatgtt |
tRNA gene sequence |
GGCTACGTAGCTCAGCTGGTTAGAGCACAGCACTCATAATGCTGGGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
atcaaagacc |
Secondary structure (Cloverleaf model) | >WENV170015920 Met CAT t ACCA atcaaagacc G - C G - C C - G T - A A - T C - G G - C T A T C G C T C A C G A A | | | | G T C T C G G C A A G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |