Sequence ID | >WENV170015952 |
Genome ID | AZIJ01005448 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 21274 |
End posion on genome | 21350 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taacctctgg |
tRNA gene sequence |
TGCGGGATGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTTGGTTCAAA |
Downstream region at tRNA end position |
atttatttat |
Secondary structure (Cloverleaf model) | >WENV170015952 Met CAT g ACCA atttatttat T T G - C C - G G - C G - C G - C A - T T A T C G A C C A T G A G | + | | | A C C G A G G T T G G C T | | | | T T G G C T C G T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |