Sequence ID | >WENV170015982 |
Genome ID | AZIJ01006085 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 896 |
End posion on genome | 972 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
agtgcgaatt |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCAACGGCCTTCTAAGCCGTCGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttaaagccct |
Secondary structure (Cloverleaf model) | >WENV170015982 Arg TCT t GCCA ttaaagccct G - C C - G G + T C - G C - G C - G G - C T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A CGGTC A - T C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |