Sequence ID | >WENV170016008 |
Genome ID | AZIJ01007505 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 174 |
End posion on genome | 100 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aggtcaaaaa |
tRNA gene sequence |
GCCGATGTAGCTCAGCTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
gaaattttgg |
Secondary structure (Cloverleaf model) | >WENV170016008 Thr TGT a TCtt gaaattttgg G - C C - G C - G G - C A - T T - A G + T T G T C T C C C A C G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |