Sequence ID | >WENV170016066 |
Genome ID | AZIJ01011260 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 89 |
End posion on genome | 164 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
atatccagat |
tRNA gene sequence |
TCTCCCATAGCTCAGTCGGTAGAGCGACGGACTGTTAATCCGCAGGTCCCTGGTTCGAGC |
Downstream region at tRNA end position |
agattctaaa |
Secondary structure (Cloverleaf model) | >WENV170016066 Asn GTT t GCCA agattctaaa T - A C - G T - A C - G C - G C - G A - T C G T G G A C C A T G A A | | | | | G C C T C G C C T G G C G | | | | T T G G A G C T A G AGGTC A C C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |