Sequence ID | >WENV170016076 |
Genome ID | AZIJ01011985 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 3441 |
End posion on genome | 3365 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaagcaaaat |
tRNA gene sequence |
TCCTCCTTAGCTCAGTTGGTTAGAGCATCTGACTGTTAATCAGAGGGTCCTTGGTTCGAG |
Downstream region at tRNA end position |
aatgaataca |
Secondary structure (Cloverleaf model) | >WENV170016076 Asn GTT t GCAA aatgaataca T - A C - G C - G T - A C - G C - G T - A C G T G A A C C A T G A A | | | | | G T C T C G C T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |