Sequence ID | >WENV170016080 |
Genome ID | AZIJ01012112 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1554 |
End posion on genome | 1629 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atccttatag |
tRNA gene sequence |
ACGGGTTTAGCTCAGTTGGTAGAGCACTGGTCTCCAAAACCAGGTGTCGGGAGTTCGAGT |
Downstream region at tRNA end position |
aagatgaaaa |
Secondary structure (Cloverleaf model) | >WENV170016080 Trp CCA g GCAA aagatgaaaa A - T C - G G - C G - C G - C T - A T - A T G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A GTGTC C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |