Sequence ID | >WENV170016081 |
Genome ID | AZIJ01012125 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 696 |
End posion on genome | 782 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
taaatattaa |
tRNA gene sequence |
GGAGAGGTGCCAGAGTGGTAATGGAGCAGATTGCTAATCTGTCGACGCGTAAGTGTCGCC |
Downstream region at tRNA end position |
tttttttgac |
Secondary structure (Cloverleaf model) | >WENV170016081 Ser GCT a GCAA tttttttgac G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A G A G | | | | | G T G A C C C A G G G C G | | | T T G A T G G T A A CGACGCGTAAGTGTCGC G + T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |