Sequence ID | >WENV170016094 |
Genome ID | AZIJ01012402 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 214 |
End posion on genome | 138 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcccccacac |
tRNA gene sequence |
GCACTCGTAGCTCAGCTGGATAGAGTACTCGGCTACGAACCGAGCGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tataaagaac |
Secondary structure (Cloverleaf model) | >WENV170016094 Arg ACG c GCCA tataaagaac G - C C - G A - T C - G T - A C - G G - C T A T C C T C C A C G A A | | | | | G T C T C G G G A G G C G | | | + T T G G A G T A T A A CGGTC C - G T - A C - G G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |