Sequence ID | >WENV170016121 |
Genome ID | AZIJ01013084 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 1400 |
End posion on genome | 1325 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caccgcagat |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGGGGTTCGACT |
Downstream region at tRNA end position |
ttccccattt |
Secondary structure (Cloverleaf model) | >WENV170016121 Ala GGC t ACCA ttccccattt G - C G - C G + T G - C C - G C - G T - A T C T T C C C C A T G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |