Sequence ID | >WENV170016158 |
Genome ID | AZIJ01013380 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 10429 |
End posion on genome | 10354 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cgaaagttac |
tRNA gene sequence |
GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCGAAGGTTCGAAT |
Downstream region at tRNA end position |
acacgacagc |
Secondary structure (Cloverleaf model) | >WENV170016158 Lys TTT c ACCA acacgacagc G - C G - C G - C T - A C - G G - C T - A T A T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |