Sequence ID | >WENV170016163 |
Genome ID | AZIJ01013754 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 2742 |
End posion on genome | 2817 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
caataaggaa |
tRNA gene sequence |
GACCTGGTAGCTCAGTTGGTAGAGCACCTCCCTTTTAAGGAGGTGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
aaagttaagc |
Secondary structure (Cloverleaf model) | >WENV170016163 Lys TTT a ACAA aaagttaagc G - C A - T C - G C - G T - A G - C G - C C G T G A C C C A T G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A TGGTC C - G C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |