Sequence ID | >WENV170016207 |
Genome ID | AZIJ01016485 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 153 |
End posion on genome | 242 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgcccgtcac |
tRNA gene sequence |
GGACAGTTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTAGGCGGGAAACCGTC |
Downstream region at tRNA end position |
cttgcctttg |
Secondary structure (Cloverleaf model) | >WENV170016207 Ser GGA c GCCA cttgcctttg G - C G - C A - T C - G A - T G - C T - A T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TAGGCGGGAAACCGTCTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |