Sequence ID | >WENV170016213 |
Genome ID | AZIJ01017133 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 212 |
End posion on genome | 295 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tggtcggtgt |
tRNA gene sequence |
GGGCGACAGGCCGCAAGGTGTGGCAGGGGACTGTAACTCCCTCGCGGAGACGCACGCCAG |
Downstream region at tRNA end position |
tttccccgac |
Secondary structure (Cloverleaf model) | >WENV170016213 Tyr GTA t ACCA tttccccgac G - C G - C G - C C - G G - C A - T C - G T T A G G T C C A A C G | | | | | G A G C C G C C A G G C G + | | | T T G T G G C T G A CGCGGAGACGCACG G + T G - C G - C G - C A - T C C T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |