Sequence ID | >WENV170016219 |
Genome ID | AZIJ01017364 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 19092 |
End posion on genome | 19018 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ctatggcaat |
tRNA gene sequence |
GGGCGTGTAGCTCAGCGGGAGAGCACTTCGTTGACATCGAAGGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
ttgccctcca |
Secondary structure (Cloverleaf model) | >WENV170016219 Val GAC t ACCA ttgccctcca G - C G - C G - C C - G G - C T - A G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G T - A T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |