Sequence ID | >WENV170016288 |
Genome ID | AZIJ01019232 |
Phylum/Class | [AZIJ] marine sediment metagenome; enrichment culture of sample MGS-ElMAX(UA) from oil contaminated site at the El-Max |
Species | |
Start position on genome | 549 |
End posion on genome | 475 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cctccggcac |
tRNA gene sequence |
GCTGTTGTAGCTCAGTGGTAGAGCACTCCCTTGGTAAGGGAGAGGTCGTGAGTTCAATCC |
Downstream region at tRNA end position |
ttttccttct |
Secondary structure (Cloverleaf model) | >WENV170016288 Thr GGT c ACCA ttttccttct G - C C - G T - A G - C T - A T - A G - C C T T C A C T C A G A A | | | | | A T C T C G G T G A G C G | | | | T T G G A G C T A A AGGTC C - G T - A C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |